15 modifying the set of attributes stored on a global catalog
Báo cáo y học: "Comparison of the quality of chest compressions on a dressed versus an undressed manikin: A controlled, randomised, cross-over simulation study" pptx
... Canada Authors’ contributions The authors have participated in design and preparation of the study (RBM, CBH, MKP, JCN), collection of data (RBM, CBH, MKP), analysis of data (all), drafting the ... group (laypeople and firefighters) using the paired t-test Stata IC 10.1 (StataCorp, Texas, USA) was used for statistical analysis An a priori analysis was done and the necessary sample size was estimated ... the supplemental study, we recorded the elapsed time associated with undressing the chest of an unconscious person (rather than a manikin) wearing three layers of clothes Each layperson was asked...
- 7
- 203
- 0
Báo cáo toán học: "On some densities in the set of permutations" ppsx
... decomposition of σ The behavior of these ordered statistics is similar, however, some technical differences arise in their analysis Section 3.2 of the paper by D Panario and B Richmond [16] contains rather ... helpful advises how to improve the presentation of the paper References [1] R Arratia and S Tavar´, The cycle structure of random permutations, Ann Probab., e 1992, 20, 3, 1567–1591 [2] R Arratia, A. D ... the electronic journal of combinatorics 17 (2010), #R100 14 [8] H.-K Hwang, Asymptotics of Poisson approximation to random discrete distributions: an analytic approach, Advances in Appl Probab.,...
- 15
- 354
- 0
Báo cáo khoa học: "Impact of the frequency of online verifications on the patient set-up accuracy and set-up margin" ppt
... sum of the standard deviations of all contributing systematic errors, s the square-root of the quadratic sum of the standard deviations of all contributing random errors, and sP the standard ... Petric MP, Catton CN, Warde PR: Portal imaging for evaluation of daily on- line setup errors and off-line organ motion during conformal irradiation of carcinoma of the prostate Int J Radiat Oncol Biol ... verification every other day relatively more than the random error (on average by a factor of 2.1 versus 1.4) An ANOVA with the Bonferroni test for post-hoc comparison of the patient set- up parameters...
- 7
- 498
- 0
International business review volume 15 issue 4 2006 doi 10 1016 j ibusrev 2006 05 001 hussain gulzar rammal; ralf zurbruegg the impact of regulatory quality on intra foreign direct investment
... include a measure of economic activity (annual GDP per capita), economic growth (change in GDP year on year), annual inflation rates (measured as a function of the local consumer price index), and an ... despite the growing economic importance of the South-East Asian region To partially rectify this lack of research, this paper examines a particular component of ASEAN trade, that of examining whether ... for the fact that in recent years, a large outflow of capital has occurred from ASEAN nation states to other growth areas, in particular China China’s ability to attract FDI has allegedly made...
- 14
- 402
- 0
The impact of online searches on consideration set formation and consumer choice
... consideration set size and similarity among the components in the consideration set? An examination of the Internet’s impact on the consideration decision is in response to calls for research on the ... consideration set formation as the pre-choice stage provide a solution to the above-mentioned limitations of one-stage choice models 2.2 Consideration Set A consideration set is the set of alternatives ... comparability of the alternatives along the product attributes (Chakravarti and Janiszewski 2003) and the situational accessibility of the brand and attribute information (Nedungadi 1990) A consumer has...
- 144
- 254
- 0
Ensuring Financial Stability: Financial Structure and the Impact of Monetary Policy on Asset Prices
... (2004), “Asset Prices, Monetary Policy and Financial Stability: A Central Banker's View,” Speech given at the American Economic Association Annual Meeting, San Diego, available at www.bankofengland.co.uk/publications/speeches/ ... rate for Belgium, Sweden and the US, and a three-month commercial paper rate for Australia, Canada and Japan.13 All interest rates are from the OECD's MEI For Finland and Denmark missing data ... panel VAR analysis also study, as a part of their robustness analysis, a subsample spanning these years and find that this later period indeed differs from the earlier part of their sample (although...
- 35
- 793
- 0
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
... TBS) A monoclonal mouse IgG1anti human anti-HLA-DR [CR3/43] was added at a concentration of 1ug/ml (Dako, Denmark), the membranes were then washed, and incubated with the secondary detection antibody, ... and washing, the primary detection antibody was added, a mouse anti human IgG1 anti-HLA-DR (CR3/43) (Dako, Denmark), at a concentration of µg/ml After a 2h incubation at room temperature, plates ... Select software (DNA Star) Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates...
- 11
- 618
- 0
The impact of extensive reading on students'
... recycle of skills over texts and tasks II.2.4 Types of reading There are a great deal of ways to classify reading such as the classification according to manners of reading and the classification according ... with an average of 205 pages To measure rate, the participants read an entire text, measured the time they spent, and calculated their wpm They read the passage times, and their rate was measured ... program The primary reason for this was the lack of published reading materials appropriate to low proficiency level Another reason was the rather prohibitive cost of setting up an ER program (Davis,...
- 52
- 979
- 3
The Impact of Signal Bandwidth on Indoor Wireless Systems in Dense Multipath Environments
... because the radius of curvature of the spherical wavefront is so large in the far field that the phase front is nearly planar over a local region [8] All of the following antenna parameters are ... quantify the power radiated from a source and reported as antenna parameters For communication engineers, these parameters are the primary means to address radiation Classically, antennas are ... Propagation Mechanisms The mechanisms that affect propagating waves after they are radiated from an antenna in general can be attributed to four propagation mechanisms Namely, reflection, refraction,...
- 210
- 712
- 0
DEVELOPING, USING AND ANALYZING THE RESULTS OF INTERVIEWS TO DETERMINE THE FEELINGS OF FOREIGN TOURISTS ON THEIR VISIT TO VIET NAM
... Because, at this time, there is a presidential racing in America, and one of them is John Mc Cain, who was an Airman in Vietnam War, who drove B52 airplane for American army Many documents, which talked ... Background a Chart of Nationality This pie chart shows us the Nationality of the tourist coming to Vietnam at this time, and divided into three occupations: tourists from European, Oceanian and ... relaxing in some Southern Eastern Asian countries: Thailand, Singapore, Laos, Cambodia, and Vietnam And the reason why the north American tourists come to Vietnam much more than before? Because,...
- 31
- 1,149
- 0
Effect of the presence of coexisting substances on UV inactivation of Cryptosporidium parvum oocysts
... Japan Wat Res., 36, 519-526 Hirata T., Chikuma D., Shimura A. , Hashimoto A. , Motoyama N., Takahashi K., Moniwa T., Kaneko M., Saito S and Maede S (2000) Effects of ozonation and chlorination on ... intensity at the surface of the suspension ***UV dose at the surface of the suspension ****Average UV dose from the surface to the bottom of the suspension Added substance Condition of added substance ... = Va V0 (3) Where, Va is the excystation rate of the UV-irradiated sample and V0 is the excystation rate of the control sample that was not subjected to UV irradiation RESULTS AND DISCUSSION...
- 8
- 358
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural...
- 16
- 727
- 0
Indoor tests to investigate the effect of brine depth on the performance of solar still
... supply a total current of 4.5 A, a voltage of 220 V and a total power flux of approximately 1000 W/m² to simulate the solar radiation intensity A variac was used to regulate the input voltage to the ... replacing the power input from solar radiation by suitable variable heating system The indoor tests allow a greater control on the input power and eliminate many factors that may affect the accuracy of ... Mallikarujanan KVS, and Karthikeyan N Concentrated Parabolic Solar Distiller with latent heat storage capacity International Journal of Chemical Engineering and Applications (2011) 185-188 [2] Horace...
- 8
- 534
- 0
The effect of EGR rates on NOX and smoke emissions of an IDI diesel engine fuelled with Jatropha biodiesel blends
... G.S., Bhat A. K Analysis of performance and emissions of a naturally aspirated stationary DI diesel engine with exhaust gas recirculation 2009 [Online] Available at: http://ssrn.com/abstract=1355005 ... Environmental Protection Agency Available at: http://www.epa.gov/climatechange/endangerment/downloads/Endangerment%20TSD.pdf Agarwal A. K., Rajamanoharan K Experimental investigations of performance ... kg of oil per hectare [2] 1.1 Jatropha Curcas Jatropha plant can grow in waste lands and consumes less water Furthermore, biodiesel produced from Jatropha has advantages compared to conventional...
- 14
- 647
- 0
THE INFLUENCE OF HUMAN ACTIVIES ON THE ENVIRONMENT
... traps heat in the atmosphere and causes the temperature of the earth to rise • This leads to disruption of the weather patterns eg drought, floods • Some weeds may thrive on the extra carbon ... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the world’s ... other plants are killed Sulphur dioxide will dissolve in rain producing Acid Rain • Acid rain damages trees and pollutes rivers and lakes Acid rain causes erosion of buildings and statues particularly...
- 23
- 390
- 0
Is Organizational e-Democracy Inevitable - The Impact of Information Technologies on Communication Effectiveness
... across divisions of an organization (Gardner, Paulsen, Gallois, Callan, & Monaghan, 2000) We present change as a process that impacts on an organization in at least two ways First, there is the ... important that education and training be aligned with technology preparation and a clear outline of the benefits to the organization Again, active dialogue at all stages of change is critical A final ... agents as another important aspect of the change and implemented at the appropriate time in the change program, with back-up and training assistance available as needed Clearly then, HR managers...
- 30
- 744
- 0
THE IMPACT OF NEW MEDIA ON ACADEMIC KNOWLEDGE
... understand, and hence what we know and understand In other words, a learner may have an image or a mental "construction" that is far richer than an abstract verbal understanding From an educational ... kinds of interaction The first is the interaction of the learner with the machine As the sophistication of multimedia design has increased, so have the types and forms of interaction, although they ... some way The professor's expertise is used to estimate the effects of changing one variable on all the others Users are then asked to input their own data and/or make decisions, and the software...
- 18
- 453
- 0
Tài liệu THE EFECT OF MAKEUP AIR ON KITCHEN HOODS ppt
... degradation due to cross drafts required a repeatable and practical disturbance For this task, a pedestal-mounted fan was located diagonally from the front corner of the hood For most of the local ... configuration, the short-circuit airflow rate can be increased accordingly, creating a condition of apparent benefit on a percentage basis For the short circuit configuration tested, the average MUA ... MUA configurations investigated, the exhaust airflow rate was set initially to the C&C rate deter- ‘Overlooking MUA delivery system details can have a negative impact on the performance of an...
- 5
- 452
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008